Reply to post: Sci Fi plot...

Picture this: An exabyte of cat pix in the space of a sugar cube of DNA

JeffyPoooh Silver badge
Pint

Sci Fi plot...

The Human Genome Project database is accidentally captured in transit and loaded into the Utah Data Center. The NSA dutifully starts cracking the code. After a few weeks, the plain text emerges:

"GATACAATCGGTACCATGGTACACA... Hi. God here. Please, call me Bob. I really do exist; and I've left this Human DNA encoded message as proof. That concept that I know that you'll call 'Last Thursdayism'? Yep, it's all true. Except about 100,000 years. Now, for Part II, please decode the DNA of cats. Good luck. GTCACTAGCATCATCGATCAT"

It's all been predicted years ago at the Library of Babel.

https://libraryofbabel.info/bookmark.cgi?godwuzhere

POST COMMENT House rules

Not a member of The Register? Create a new account here.

  • Enter your comment

  • Add an icon

Anonymous cowards cannot choose their icon

SUBSCRIBE TO OUR WEEKLY TECH NEWSLETTER

Biting the hand that feeds IT © 1998–2019