back to article US teen clocks up 14,528 text messages

Greg Hardesty of the Orange County Register has described himself as "speechless" after his 13-year-old daughter "racked up 14,528 text messages in one month", as the shaken dad himself put it last week. Hardesty, 45, explains that offspring Reina achieved the impressive SMS tally between 27 November and 26 December. Her 22- …


This topic is closed for new posts.


Anonymous Coward



Silver badge
Paris Hilton

Texting is just email for kids

Why anyone would use it if they have access to real email is a mystery to me.

Having said that this girl obviously has some sort of obsessive disorder and probably needs help.

Paris Hilton


She'll be arthritic by 16.

Assuming that she never eats, sleeps or bathes, that's one every 2.9 minutes. Does the AT&T contract have a fair usage clause?

More realistically, assuming that she's like most other teenage girls and spends 75% of the time either asleep or in the shower, that's one every 44 seconds.

Paris because that question mark is what her fingers will look like soon.


No fair usage policy, what?

484 per day, 40 per waking hour, 0.67 texts per minute!

^ I'm bored and have a calculator ^

Paris Hilton

why is he bothered?

if she has an unlimited text plan ?

And its not just for kids.... I'm a long way from being a kid, well chronologically anyway, and I average around 2000 texts a months..



Estimation: 14000 texts in 30 days, 16 waking hours a day = approximately one text every two minutes for a month.

Anonymous Coward


"Why anyone would use it if they have access to real email is a mystery to me."

Because they might want to send a message to somebody who doesn't have email on their mobile phone? This is still most people...


Multiple recipients

I assume that she is sending some of her texts to everyone in her address book - or at least to groups of friends at a time.

I have a teenage daughter


The worrying thing is...

... that her parents didn't notice her texting as often as she must have been...


I just can't be trying!

Hmm. Makes my total of around 200 in 10 years even punier than I thought! Still, at least they were all properly spelt, capitalised, and punctuated. Bet she can't claim that - it takes time to find all those semi-colons!

Paris Hilton

RE: Texting is just email for kids

Why, um, anyone would, um, use it if they, you know, have access to, um, a phone, on which they could, um, carry on an actual, you know, um, conversation is a mystery to me.

Paris, because she knows what thumbs are REALLY for.

IT Angle

Divided by 2

Assuming that for every text she sent she got a reply, and taking into account she receives FW:FW:FW:FW:FW:FW: LOL texts, lets take her down to 7000 outgoing texts.

Which works out at 233 per day. (14 per waking hour (16))

Is that really a newsworthy number? December, school holidays, she was probably using her phone like an IM client....could easily fire through 50 in a couple of bored hours..


Ban texts after dinner?

How about banning texts during SCHOOL HOURS? There's no way she did all of that in her free time.

Silver badge
Paris Hilton


"I average around 2000 texts a months.."

A grown man sending 70 texts a day? You need help mate. Or an email account.



Anyone who's texting more than 20 messages a month needs treatment unless someone's paying *them* to do it, frankly. Free just isn't good enough to make up for the colossal waste of time this is.

Gates Halo

it's the number delivered

If I understand my plan correctly, AT&T charges for every message *delivered*. So, if you're sending broadcast messages to a 25 person list (e.g. if you're one of the 'social organizers' in your clique), you can hit the 400/month limit pretty darn quickly ... Yeah, with teens, "unlimited" is definately the right option for any wireless plan. (I think they have too much time on their hands.)

Paris Hilton

Remember that americans are charged for incoming texts..

14000 a month, divide that by 2 as they are charged for incoming texts.

So thats 7k texts sent potentially - in response to texts sent.

Divide that my 30 days in an average month... 233.333... (lets call it 233)

Divide that by the average time awake (16hours) equals 14.5625.

One text every 14.5625 minutes sent... that's kinda doable if your having text sex or a horny teenager.

Paris, cos she bangs horny teenagers (but only slept with 2 people).

Black Helicopters

@Texting is just email for kids

"Why anyone would use it if they have access to real email"

Between walled-garden messaging on Facebook, bebo etc. and texts, maybe it's email that's on the way out?...

Black helicopter for the amount of monitoring that can be put on walled-garden messaging.

Anonymous Coward

I confess, I cracked 14,000 in one month

And that was in one direction

OK, I admit it was an automated text sending a status/GPS location every 5 minutes, and I was asked to stop as it's against my "fair use" policy on my supposed "unlimited" contract.

My daughter gets pretty close to her unlimited ("fair use, read 3000") contract most months.



"Text-messaging is now hard-wired into our culture. It's in our DNA."

At last. An explanation for all those text messages I keep receiving that say "CAGGTTACGTACGATTACGGGCTCA"

I've registered the gene at the patent office, and called it "Txt2u"

Mine's the white one with the pens in the breast pocket.


I'm with Mr Multiple Recipitents above

I have a friend who writes very long (hilarious) text messages. Sometimes they are 8 messages long, and they crease me up. He sends these to about 20 people at a time. Now you can see where that huge number comes from, as that's 160 messages used in the couple of minutes it took him to write it.

If that was 14,000 *unique* messages then that would be frankly astonished.


What this shows

Given the precise numbers involed it's amazing that everybody with a calculator came up with a different rate of text sending. You should all work in the statistical office :)

Paris Hilton

Re: it's the number delivered

Agree - if you give a teenager a recent nokia or anything else that can send an SMS to a list in a couple of clicks you will end up with 5K plus messages in a jiffie.

This is US as well. Don't they also charge you for receiving messages so is this just messages sent or messages received as well?

Anonymous Coward

Must be selling crack

She's probably selling and doing crack.

Thumb Down

Re: Sado

Robert, hardly. When you only own a mobile (because you have 3G broadband) and you don't want to pay up to £1.20/minute for calls to relatives in the rest of the world, or pay people like Toucan or Alpha or other third-party connection services for voice, text messages come in very handy, especially if you manage to say in four (or more) text messages what would've taken a minute to say over the phone (from a purely voice perspective).

So no, then we're not saddos but rather use a feature on our mobiles that is designed for short messages (after all, it's called Short Messaging Service).

Also, you seem to fail to realise that in the US, consumers pay for incoming messages as well as outgoing ones, so you pay for every MMS, every service message sent by your provider. And when you're in this uniquely Nokia thing called a chat (I think the T-Mobile Sidekick has something similar, and the AT&T iPhone rearranges SMS messages into a chat-like thread), it's easy to lose track how many messages are sent in a conversation.

Since the customer in question is on AT&T, what are the chances that the little one has an iPhone?


I average around 4k a month

Though work pays for the phone and im expected to be on call all the time so yeah im gonna get getting my moneys worth out of the phone.

Though if this was my daughter, REGARDLESS OF HAVING AN UNLIMITED PLAN OR NOT I would slap her silly. Damn she needs help.

/mines the one with the phone in the pocket on silent.


oh carp ...

i suddenly feel old. I dopn;t even know how to send a text message on my phone... then again i still use a rotary dial one.


Text messages

Why is this a story? My 16 year old daughter averages over 20,000 text a month. Our november bill has 23,380 outgoing text and the December bill has 24,060 outgoing text. when we took her phone into Verizon the guy behind the counter said that he had never seen that many text. Even with all this texting she maintains her grades and plays sports. But I'm glad we have unlimited texting because I wouldn't want to have to pay for the text.

Anonymous Coward


I really hate texting. It's so much easier to leave a voice mail msg. I wouldn't have done this in my younger days when I wasted a couple hours a day playing tetris on a desktop, mostly because the keypad is ridiculously small and your just wearing out keys to a phone that cost more than it's really worth. Then again, if the parents are dumb enough to pay for it and not make their kids work for it, I can see why. I think I've managed about a dozen in the past five years.


Don't suppose anyone has any stats on what this would cost AT&T?

I suspect that AT&T really won't be too bothered about this volume of texting. A quick check of my phone looks like text messages are just the ASCII character set, and you only get 160 characters per text. So I would have thought that apart from the handshakes to actually send the messages, this is costing them peanuts - 160B per message.

Any thoughts / stats?


Divide by more than 2

Consider 5 girls each OMGing and LOLing eachother through a 4 person list - a scenario that seems more common than just 1:1 texting. Every text sent by each girl == 4 sends and 4 receives. Any one girl will get an average of 4 texts for each one she sends.

That would take it down to only 3000 sends per month - or 100 per day. - or less than 10 per hour.

Amazing they've got so much to say seeing they can only spare three syllables per day for their family.


Not the first spammer, won't be the last.

Not the first spammer, won't be the last.

I figure 20 people in her contact group, message to everyone "waz up" They all return the favor with a reply to all "nuthin you?" even with some auto-reply alls to those reply all's "in da showa" Then 20 idiots frantically trying to delete a crap load of stupid messages. Then repeat this crap every hour or so during breaks etc.

.... correction, they probably don't ever delete old messages. So 200 Gigs of "whatevs" and growing on some poor server somewhere.


not as bad as that.

Assume the following: (1) that there is AT LEAST one incoming for every outgoing message. (2) that not all incoming are replied to given that they are "annoying forwards". So it's less than 7000 msgs in one month. Given that many of them will also be just "LOL", and other things that can be sent in 3 seconds one-handed, it's not as bad as some people are making out here.

Personally, I find it weird. But I don't own a mobile phone anymore as I found I didn't like being leashed. Lots of people find THAT weird, so who am I to judge?


Please, somebody challenge this ...

"Text-messaging is now hard-wired into our culture"

What ???

Obviously no idea what "hard-wired" means ...



... actually *meaning* "unlimited"? Wow! There's an idea!!

Thumb Down

Fair Use

As a student I previously averaged 1700 per month. I was on BT Genie's "unlimited" texts plan which was brilliant. Especially as a student - why phone when you can text for free?

And then I hit 2300 txts in 1 month and ran into what I discovered was called a "Fair Use" clause - and they capped me at 600.

This was back in 1999/2000.


Ha ha you are old

Old fools don't get text their brains are too obsolete. On behalf of the T9 brigade I say Dual you aunt.



Robert Long

Sorry for anon, I keep meaning to make an account. First post :-)

I have to agree; I hate mobiles. I'm an IT tech for a national firm. Never could get the hang of them.

Thumb Down

Wrong tool for the job?

My girlfriend has the same annoying habit of using texts excessively. She'll often spend half an hour texting every minute or two to sort something that could easily be resolved in thirty seconds if she would PICK UP THE PHONE AND MAKE A CALL WITH IT. You know, like phones are supposed to be used? I can see how you can rack up that amount of texts - it isn't clever, it just shows you don't know how to use your phone effectively.

Personally, I agree with Robert Long - 20 texts a month is plenty.


RE: Texting is just email for kids

@ boltar: For the same reason they annoy you with messages via $social_network or $IM instead of sending you a proper e-mail: Because they are morons and do not spend a split second thinking about whether there might be a more clever way of communicating involving less hassle and/or cost. These are the people who even in their late twenties still do not employ a proper e-mail client but only their freakin' webmailer. Some of these people do not even know that there there are such things as e-mail clients. These are the people who, if they bother with e-mail at all, send TOFU HTML, forward "funny" PPTs, and stuff even the smallest bit of text into attached DOCs. In short, the kind that doesn't give a rats ass about anything but their own most imminent desires and in a better world should not be allowed within ten feet of a computer in the first place. These are the people that will make the Palm Pre a boiling success, as they BUG you to no end on ALL platforms and channels available to them EXCEPT e-mail, as honestly e-mail is just too compatible and convenient on the receiving end so you are clearly not devoting enough time to their important inquiry, and the Pre will help you _sort that shit out_. Can't wait!

@ Chris: Because text has a lot of advantages compared to a call, think about it.


little excessive?

Has the world gone mad? Stop it here and let me off.

I think I've sent 4-5 text messages in the 8 years I've had a cell, and they've all been through the online page my provider has. But then again I haven't gone over 30min of talk time in a month on any of my contracts so I'm a big exception. I use a laptop and free wifi to use email, why pay for it on my cell?


He has to pay for this?

As a parent of a US teenager I can't believe any similar parent is unaware of how popular texting is. Most kids would be just as happy with their cell phone if it couldn't make voice calls, as long as the texting was free.

All you do is sign up for an unlimited texting plan. They usually cost between $20-$30 a month (15-20 quid) and include a limited amount of freee voice calling time.

Don't ask me why kids prefer texting over talking, they just do. For example I tried to call my kid one afternoon to find out when he wanted to get picked up, and while 4 calls went unanswered a text message was replied to in seconds.

I don't get it or like it, but it just is. As the text plan is less expensive than the equivalent voice plan I don't see the harm.

Silver badge

RE: Don't suppose anyone has any stats on what this would cost AT&T?

I do not have stats, but here is thought : SMS are not using the same data chanel as voice calls; they are using control channel which would normally be used to connect your phone to a BTS, initiate or receive a call etc. This means that the more text messages BTS has to handle, the higher possibility it will fail to connect (someone else's) call - because there simply won't be control channel available at the time.


I'm with Martin Kirk

Send a tiny numbers of txts, but all properly spelt, capitalised, and punctuated. Take idle pleasure in constructing long elaborate messages with addendums and references....


This post has been deleted by its author


Not entirely sure what the fuss is about

To those who are ranting and raving about how evil texting is. Bear in mind that different people communicate in different ways. Because YOU don't "approve" doesn't make it inherently wrong as last I looked none of you lot were ordained "keeper of universal standards for interpersonal communications" and as such need take your holier than thou attitudes with you whilst taking a long walk off a short pier.

Given that the 14K number is most likely sent and received also given that this is a teen age girl and as such is probably forwarding messages to multiple recipients. Then the number cited is not as excessive as one might think it is. Lets face it the actual number of single recipient texts sent is certainly much lower than the number stated in the headline and therefor wouldn't have been near as sexy and attention grabbing as what equated to "Oh my god look at this text addicted teenager, look at the poor dear. wont someone please think of the children" headline.

So the guy has an unlimited text plan with his carrier and one of his kids used it to it's fullest. Ok, and?? We know that teen's in particular prefer text/IM/e-mail over talking on the phone. This has been shown and reported on time and time again so I fail to see the outrage at this. The kid was doing what kids today do. Being surprised by this is a bit like being surprised that the sun rises in the east and sets in the west. Now personally I'm far from a teen but having spent eight years in a call center doing technical support I have pretty much been put off talking on the phone and do so as little as possible. I'd much rather talk face to face, e-mail, text, or IM. A great many of my friends even those who haven't shared my previous experience on the hell desk are of the same mind, all of us in our mid 30's to early 40's.

Anonymous Coward

Aw, this is funny

A bunch of grownups posting *article comments* on a tech magazine, talking down their noses at teen text users and their frivolous, wasteful dumb antics. Such irony!

And what are we communicating?

Email's better than text; if you send too many texts there's 'something wrong with you'; using webmail in your late 20s is *wrong*.... the list adds up, mostly of people dying to express how superior they feel to people who "should not be allowed within ten feet of a computer in the first place"

Honestly, I invite any contributors to this thread to re-read the bickering, the aloofness and the general autism spectrum behaviour then explain to me why this has more value than some teenager sending 14,000 LOLs.

People communicate at different rates and in different media. Big fucking deal. At least that teenage girl probably has *friends*

Anonymous Coward

Proof parents are as illiterate and irresponsible as their offspring

Ya just gotta love it.

Just let them kids text away and rationalize their illness. Then parents wonder why their kids have learning, behavioral and social problems that the parent have no clue about... If I have to explain it to you, you wouldn't understand and certainly should not be producing offspring.

Silver badge
Thumb Down

Paying to receive sms

How quaint. The point of it being what exactly? Some tosser sends me an unsolicited message and I pay for the privilege? That's f***ed.


Texting vs. talking

Unless you got a huge-arse zillion-minute mobile plan, texting can be 5x or 10x cheaper than calling. Here in Mexico, most mobile users are in the pre-paid plans, where texting is under MXN $1 (that's about $0.08 in USD's); most people will rather send SMS messages than waste airtime.

Even those of us with a "post-pay" plan (that is, with a contract) prefer to use SMS for most things and keep actual voice calls for important stuff.

Oh, the good thing: we don't pay for *incoming* SMS.



This topic is closed for new posts.


Biting the hand that feeds IT © 1998–2017