Why anyone would use it if they have access to real email is a mystery to me.

Having said that this girl obviously has some sort of obsessive disorder and probably needs help.

She'll be arthritic by 16.

Assuming that she never eats, sleeps or bathes, that's one every 2.9 minutes. Does the AT&T contract have a fair usage clause?

More realistically, assuming that she's like most other teenage girls and spends 75% of the time either asleep or in the shower, that's one every 44 seconds.

Paris because that question mark is what her fingers will look like soon.

484 per day, 40 per waking hour, 0.67 texts per minute!

^ I'm bored and have a calculator ^

if she has an unlimited text plan ?

And its not just for kids.... I'm a long way from being a kid, well chronologically anyway, and I average around 2000 texts a months..

I assume that she is sending some of her texts to everyone in her address book - or at least to groups of friends at a time.

I have a teenage daughter

Hmm. Makes my total of around 200 in 10 years even punier than I thought! Still, at least they were all properly spelt, capitalised, and punctuated. Bet she can't claim that - it takes time to find all those semi-colons!

Why, um, anyone would, um, use it if they, you know, have access to, um, a phone, on which they could, um, carry on an actual, you know, um, conversation is a mystery to me.

Paris, because she knows what thumbs are REALLY for.

Assuming that for every text she sent she got a reply, and taking into account she receives FW:FW:FW:FW:FW:FW: LOL texts, lets take her down to 7000 outgoing texts.

Which works out at 233 per day. (14 per waking hour (16))

Is that really a newsworthy number? December, school holidays, she was probably using her phone like an IM client....could easily fire through 50 in a couple of bored hours..

How about banning texts during SCHOOL HOURS? There's no way she did all of that in her free time.

"I average around 2000 texts a months.."

A grown man sending 70 texts a day? You need help mate. Or an email account.

Anyone who's texting more than 20 messages a month needs treatment unless someone's paying *them* to do it, frankly. Free just isn't good enough to make up for the colossal waste of time this is.

If I understand my plan correctly, AT&T charges for every message *delivered*. So, if you're sending broadcast messages to a 25 person list (e.g. if you're one of the 'social organizers' in your clique), you can hit the 400/month limit pretty darn quickly ... Yeah, with teens, "unlimited" is definately the right option for any wireless plan. (I think they have too much time on their hands.)

14000 a month, divide that by 2 as they are charged for incoming texts.

So thats 7k texts sent potentially - in response to texts sent.

Divide that my 30 days in an average month... 233.333... (lets call it 233)

Divide that by the average time awake (16hours) equals 14.5625.

One text every 14.5625 minutes sent... that's kinda doable if your having text sex or a horny teenager.

Paris, cos she bangs horny teenagers (but only slept with 2 people).

"Why anyone would use it if they have access to real email"

Between walled-garden messaging on Facebook, bebo etc. and texts, maybe it's email that's on the way out?...

Black helicopter for the amount of monitoring that can be put on walled-garden messaging.

"Text-messaging is now hard-wired into our culture. It's in our DNA."

At last. An explanation for all those text messages I keep receiving that say "CAGGTTACGTACGATTACGGGCTCA"

I've registered the gene at the patent office, and called it "Txt2u"

Mine's the white one with the pens in the breast pocket.

Given the precise numbers involed it's amazing that everybody with a calculator came up with a different rate of text sending. You should all work in the statistical office :)

Agree - if you give a teenager a recent nokia or anything else that can send an SMS to a list in a couple of clicks you will end up with 5K plus messages in a jiffie.

This is US as well. Don't they also charge you for receiving messages so is this just messages sent or messages received as well?

Robert, hardly. When you only own a mobile (because you have 3G broadband) and you don't want to pay up to £1.20/minute for calls to relatives in the rest of the world, or pay people like Toucan or Alpha or other third-party connection services for voice, text messages come in very handy, especially if you manage to say in four (or more) text messages what would've taken a minute to say over the phone (from a purely voice perspective).

So no, then we're not saddos but rather use a feature on our mobiles that is designed for short messages (after all, it's called Short Messaging Service).

Also, you seem to fail to realise that in the US, consumers pay for incoming messages as well as outgoing ones, so you pay for every MMS, every service message sent by your provider. And when you're in this uniquely Nokia thing called a chat (I think the T-Mobile Sidekick has something similar, and the AT&T iPhone rearranges SMS messages into a chat-like thread), it's easy to lose track how many messages are sent in a conversation.

Since the customer in question is on AT&T, what are the chances that the little one has an iPhone?

Though work pays for the phone and im expected to be on call all the time so yeah im gonna get getting my moneys worth out of the phone.

Though if this was my daughter, REGARDLESS OF HAVING AN UNLIMITED PLAN OR NOT I would slap her silly. Damn she needs help.

/mines the one with the phone in the pocket on silent.

"Text-messaging is now hard-wired into our culture"

What ???

Obviously no idea what "hard-wired" means ...

As a student I previously averaged 1700 per month. I was on BT Genie's "unlimited" texts plan which was brilliant. Especially as a student - why phone when you can text for free?

And then I hit 2300 txts in 1 month and ran into what I discovered was called a "Fair Use" clause - and they capped me at 600.

This was back in 1999/2000.

Robert Long

Sorry for anon, I keep meaning to make an account. First post :-)

I have to agree; I hate mobiles. I'm an IT tech for a national firm. Never could get the hang of them.

My girlfriend has the same annoying habit of using texts excessively. She'll often spend half an hour texting every minute or two to sort something that could easily be resolved in thirty seconds if she would PICK UP THE PHONE AND MAKE A CALL WITH IT. You know, like phones are supposed to be used? I can see how you can rack up that amount of texts - it isn't clever, it just shows you don't know how to use your phone effectively.

Personally, I agree with Robert Long - 20 texts a month is plenty.

@ boltar: For the same reason they annoy you with messages via $social_network or $IM instead of sending you a proper e-mail: Because they are morons and do not spend a split second thinking about whether there might be a more clever way of communicating involving less hassle and/or cost. These are the people who even in their late twenties still do not employ a proper e-mail client but only their freakin' webmailer. Some of these people do not even know that there there are such things as e-mail clients. These are the people who, if they bother with e-mail at all, send TOFU HTML, forward "funny" PPTs, and stuff even the smallest bit of text into attached DOCs. In short, the kind that doesn't give a rats ass about anything but their own most imminent desires and in a better world should not be allowed within ten feet of a computer in the first place. These are the people that will make the Palm Pre a boiling success, as they BUG you to no end on ALL platforms and channels available to them EXCEPT e-mail, as honestly e-mail is just too compatible and convenient on the receiving end so you are clearly not devoting enough time to their important inquiry, and the Pre will help you _sort that shit out_. Can't wait!

@ Chris: Because text has a lot of advantages compared to a call, think about it.

Send a tiny numbers of txts, but all properly spelt, capitalised, and punctuated. Take idle pleasure in constructing long elaborate messages with addendums and references....

They are talking with each others will txting... and sometimes holding 2 or three talks at the same time with different groups around them.

And can forward messages between them all over!

;)

To those who are ranting and raving about how evil texting is. Bear in mind that different people communicate in different ways. Because YOU don't "approve" doesn't make it inherently wrong as last I looked none of you lot were ordained "keeper of universal standards for interpersonal communications" and as such need take your holier than thou attitudes with you whilst taking a long walk off a short pier.

Given that the 14K number is most likely sent and received also given that this is a teen age girl and as such is probably forwarding messages to multiple recipients. Then the number cited is not as excessive as one might think it is. Lets face it the actual number of single recipient texts sent is certainly much lower than the number stated in the headline and therefor wouldn't have been near as sexy and attention grabbing as what equated to "Oh my god look at this text addicted teenager, look at the poor dear. wont someone please think of the children" headline.

So the guy has an unlimited text plan with his carrier and one of his kids used it to it's fullest. Ok, and?? We know that teen's in particular prefer text/IM/e-mail over talking on the phone. This has been shown and reported on time and time again so I fail to see the outrage at this. The kid was doing what kids today do. Being surprised by this is a bit like being surprised that the sun rises in the east and sets in the west. Now personally I'm far from a teen but having spent eight years in a call center doing technical support I have pretty much been put off talking on the phone and do so as little as possible. I'd much rather talk face to face, e-mail, text, or IM. A great many of my friends even those who haven't shared my previous experience on the hell desk are of the same mind, all of us in our mid 30's to early 40's.

How quaint. The point of it being what exactly? Some tosser sends me an unsolicited message and I pay for the privilege? That's f***ed.